Archives
March 2012 (19)February 2012 (1)
August 2011 (1)
May 2011 (40)
February 2011 (4)
November 2010 (17)
October 2010 (17)
September 2010 (26)
August 2010 (4)
April 2010 (45)
March 2010 (19)
December 2009 (5)
November 2009 (2)
September 2009 (11)
August 2009 (7)
July 2009 (2)
June 2009 (5)
March 2009 (1)
February 2009 (95)
December 2008 (6)
November 2008 (47)
October 2008 (56)
Sections
Data (136)Materials (183)
Note (5)
Procedure (21)
Procedures (74)
Templates (11)
Material
Solution (150)Powder (12)
Suspension (1)
Data Type
SAXS Lab (9)SANS LOQ (5)
UV-VIS (11)
Sequence DNA (1)
UV-Vis (9)
SAXS Diamond (74)
SANS (22)
SANS SANS2d (5)
Procedure
UV-Vis (4)SANS (12)
SAXS Lab (1)
DNA Ligation (2)
Chemistry (1)
Data Analysis (2)
PCR (1)
DNA Phosphorylation (1)
SAXS (12)
Sample Preparation (1)
Data Analysis (6)
Transformation (1)
Protein Purification (5)
SDS PAGE (4)
Sample Preparation (4)
Data Reduction (4)
Protein Purification (4)
Synchrotron CD (3)
Purification (4)
Instrument
LOQ (7)SAXSess Bath (1)
I22 (84)
SANS2d (7)
SANS2D (21)
Dna
Oligonucleotide (12)Double Stranded Linear (4)
Plasmid (1)
Glur0 (2)
Project
Laser Tweezers Tus (6)Mthk (12)
Kcsa (1)
Reaction Centre (2)
SAS Standard (27)
GluR0 (16)
Tus Labelling (6)
JHL (6)
Soton (26)
MurM (2)
Test (1)
Data Analysis (1)
Glur0 (48)
Frey-King Surfactants (1)
SANS2dfirstbio (9)
Pins (1)
GlurO (1)
Protein-ligation (3)
Smalp (40)
NIMROD-March-2012 (1)
Tools
Show/Hide Keys
Dna: oligonucleotide
Material: Solution
This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;
Material: Solution
| Property | Data |
| Name | kcsa-sort-bwd |
| Number | |
| Location | |
| Sequence | CTGCCGGGTACCGGTGGTGCGCAGCTGATCACGTATCCGC |
| Length | 40 |
| Melting temp | 71 (64) C |
| Supplier | Invitrogen |
| Stock concentration | 100 uM |
This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;
Dna: oligonucleotide
Material: Solution
This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;
Material: Solution
| Property | Data |
| Name | kcsa-sort-fwd |
| Number | |
| Location | |
| Sequence | CGCACCACCGGTACCGGCAGACCTGCGCCGCCTCAGCCAG |
| Length | 40 |
| Melting temp | 74 (64) C |
| Supplier | Invitrogen |
| Stock concentration | 100 uM |
This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;
Material: Solution
Dna: oligonucleotide
prepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of oligo-biotin-lambda to lambda DNA;Phosphorylation of DNA substrates for laser tweezers experiment;
Dna: oligonucleotide
prepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of oligo-biotin-lambda to lambda DNA;Phosphorylation of DNA substrates for laser tweezers experiment;
Material: Solution
Dna: oligonucleotide
Prepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;
Dna: oligonucleotide
Prepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;
Material: Solution
Dna: oligonucleotide
Prepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;
Dna: oligonucleotide
Prepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;